Human NCAM-1/CD56 Protein, His TagProduct Propertie Alternative Names NCAM1,NCAM,NCAM 1,N CAM 1 Species Human Expression Sequence Leu20 Gly718 Accession P13591 2 Tag C His Expression System HEK293 Molecular Weight The protein has a predicted MW of 78. 48 kDa. Due to glycosylation, the protein migrates to 95 115 kDa based on SDS PAGE result. Purity > 95% as determined by SDS PAGE and HPLC. Endotoxin < 1. 0 EU per g by the LAL method. Formulation Lyophilized from 0. 22m filtered

GoldBand™ 3-color Low Range Protein Marker (2

Among IL-17 family members

It contains Ala35-Ser779

a 21 aa transmembrane domain and a 155 aa C-terminal extracellular domain

5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGT*C-3´

Dose response curve for Anti-P-Selectin Antibody

P17301-1(ITGA2)&P05556-1(ITGB1)

The ED50 as determined by inhibiting IGF-II induced proliferation of serum free human MCF-7 cells is less than 200 ng/mL

The kit contains a genetically engineered DNA polymerase combination with high fidelity and resistance to PCR inhibitors

400μL/well

FGF family members have a wide range of activities that promote mitosis and cell survival

90 kDa (ITGAV)&101